<<
>>

ОСОБЕННОСТИ МИТОХОНДРИАЛЬНОГО ГЕНОМА НА ПРИМЕРЕ ЦИТОХРОМА B АЛТАЙСКИХ ОСМАНОВ (OREOLEUCISCUS WARPACHOWSKI) МОНГОЛИИ

Е.И. Лаврова, Ю.В. Слынько

Учреждение Российской академии наук Институт биологии внутренних вод им. И.Д. Папанина РАН, п. Борок, Ярославская обл., Россия

e-mail: lavr@ibiw.yaroslavl.ru

Алтайские османы, принадлежащие к роду Oreoleuciscus Warp., представляют своеобразную группу карповых рыб.

Они являются характерными обитателями внутренних водоемов северо-за­падной Монголии, бессточных озер Монгольского Гоби и юго-восточного Алтая.

Попытки характеристики различных видов этого рода показали, что морфологические при­знаки османа довольно изменчивы не только у рыб из различных водоемов, но даже и у особей из одного и того же водоема. Затрудняет решение вопроса также наличие в некоторых водоемах круп­ных и мелких форм, представленных половозрелыми особями резко различного размера.

В последнее время для решения подобных таксономических проблем , а также для выяснения родственных связей и эволюции таксонов в различных группах организмов (как животных, так и растительных) широко применяются молекулярно-генетические методы исследований.

В этой связи нами предпринята попытка найти универсальный метод идентификации рыб, от - носящихся к данному роду, обитающих в различных регионах Монголии. В данной работе приведе­ны первые, предварительные результаты исследований митохондриальной ДНК (мтДНК) монголь­ских османов.

Материалом для исследования послужили образцы мышечной ткани рыб, фиксированные в 96%-ном этиловом спирте. Были проанализированы выборки из следующих водоемов: озера Сангийн-Далай-Нур (большое и малое), оз. Тэлмен-Нур, оз. Хага-Нур, оз.Бон-Цаган-Нур, оз. Толбо-Нур, оз. Увс-Нур и реки Та- цын-Гол. Изменчивость мтДНК исследована с помощью анализа полиморфизма длины рестрикционных фрагментов (ПДРФ) гена цитохрома b (длина 1050 пар нуклеотидов), амплифицированного в полимеразной цепной реакции (ПЦР). ДНК выделена по стандартной методике, включающей лизис ткани 1%-ным SDS в присутствии протеиназы К (0,2 мг/мл) и депротеинизацию фенолом.

Для ПЦР использованы олигонуклео­тидные праймеры, разработанные для анализа цитохрома b у карповых рыб:
Наименование праймера Sequence (5'-3')
1 Phox-Cytb-F GAAAGACTCACCCGCTAATAAAAATCGC
2 Phox-Cyt-R CACGCTAAGCTACTAGGGCAAGCTC
3 Phox-Cytb-GluF GAAGAACCACCGTTGTTATTCAA
4 Phox-Thr-R ACCTCCRATCTYCGGATTACA

Амплификация проведена в 25 мкл реакционной смеси, содержащей по 1 мкл разведенного

праймера, 2,5 мкл 10-кратной смеси dNTP, 2,5 мкл Taq-буфера, 0,5 единицы активности Taq ДНК- полимеразы и 100-200 нг тотальной ДНК, в течение 30 циклов в температурном режиме: 95о С - 1 мин, 50 о С - 1 мин, 72 о С - 1 мин.

Для рестрикционного анализа гена цитохрома b митохондриальной ДНК использован набор из пяти эндонуклеаз рестрикции: Hinf I (сайт рестрикции GANTC), Ava II (GGA/TCC), Rsa I (GTAC), Hae III (GGCC), Alu I (AGCT). После предварительного анализа было решено остановить­ся на первых трех эндонуклеазах. Alu I показала отсутствие специфических сайтов рестрикции.

Фрагменты рестрикции митохондриальной ДНК разделены с помощью электрофореза в 1,5%- ном агарозном геле и в 5%-ном полиакриламидном геле в трис-боратном буфере. Для определения длины полученных фрагментов использованы маркерные наборы фрагментов ДНК, кратных 100 пн и 50 пн. Гели были окрашены бромистым этидием и сфотографированы в УФ-свете. Для получения более тонких результатов ПЦР-продукт анализировали одновременно двумя рестриктазами и разго­няли в 5% акриламидном геле, что дало возможность построить рестриктную карту (для выборок Сангийн-Далай-Нур, Тэлмен-Нур, Хага-Нур) (Рис.1).

Рис.

1. Рестриктная карта гена цитохрома b мтДНК для османов Монголии

Количество сайтов рестрикции по проанализированным эндонуклеазам следующее: Hinf I - 1, Ava II - 3, Rsa I - 2, Hae III - 4, Alu I - 0. Анализ рестриктных сайтов показал отсутствие полимор­физма по данным эндонуклеазам во всех исследованных выборках, кроме одной - Бон-Цаган-Нур. Кроме того османы Бассейна Долины озер (Бон-Цаган-Нур, Тацын-Гол) имеют явные отличия в расположении сайтов рестрикции по эндонуклеазе Hinf I (Рис.2).

Рис. 2. Форез рестрикции по эндонуклеазе Hinf I: 1-3 дорожки - Сангийн-Далай-Нур (большое), 4-6 - Тэлмен-Нур, 7-9 - Хага-Нур, 10-12 - Бон-Цаган-Нур

Полученные первые данные рестриктного анализа гена цитохрома b мтДНК монгольского ос­мана свидетельствуют о консервативности большинства исследованных выборок по данному гену. Но некоторые результаты ( различия у особей из бассейна Долины озер) требуют дальнейших де­тальных исследований - секвенирования.

Литература

Алтухов Ю.П., 2003. Генетические процессы в популяциях. 3-е изд., перераб и доп. М.ИКЦ «Академкнига».

Кафанова В.В., 1961. Материалы к систематике алтайских османов рода Oreoleuciscus Warpachowski // Вопросы ихтиологии.Т.І. Вып.1(18). С.9-18.

Sasaki T., Kartavtsev Y.P. et al., 2007. Genetic divergence and phylogenetic independence of Far Eastern species in subfamily Leuciscinae (Pisces: Cyprinidae) inferred from mitochondrial DNA analyses // Genes

Genet.Syst. 82. P.329-340.

Zardova R., Doadrio I., 1998. Phylogenetic relationships of Iberian cyprinids: systematic and biogeographycal implications // The Royal Society. Proc. R. Soc.Land.B 265. P.1365-1372.

THE MITOCHONDRIAL GENOME CHARACTERISTICS BY THE EXAMPLE OF

CYTOCHROME b AT ALTAI OSMANS (OREOLEUCISCUS WARPACHOWSKI) OF MONGOLIA E.I. Lavrova, Yu.V. Slynko

Papanin Institute for Biology of Inland Waters, Russian Academy of Sciences,

Borok, Yaroslavl reg., Russia, e-mail: lavr@ibiw.yaroslavl.ru

Altai osmans (Oreoleuciscus Warpachowski) represent an original group of Cyprinidae.

They are the representative inhabitants of internal reservoirs (inland waters) of northwest Mongolia, internal-drainage lakes of the Mongolian Gobi and the southeast Altai. The attempts to characterize the different species of this genus have shown the sufficient variability of morphological signs not only at fishes from various reservoirs, but even at individuals from the same one. The presence in some reservoirs large and small morphological forms presented by mature fishes of sharply various sizes also complicates the question decision. Thus an attempt to find a universal method of identification the fishes belonging to the given genus and living in various regions of Mongolia was made. At given work the first preliminary results of researches on mitochondrial DNA (mtd DNA) of Mongolian osmans are presented. For the restriction analysis of gene cytochrome b at mitochondrial DNA the set from five endonucleases of restriction was used: Hinf I (restriction site

GANTC), Ava II (GGA/TCC), Rsa I (GTAC), Hae III (GGCC), Alu I (AGCT). The quantity of

restriction sites concerning the analyzed endonucleases is the following: Hinf I - 1, Ava II - 3, Rsa I - 2, Hae III - 4, Alu I - 0. The analysis of restriction sites has shown the absence of polymorphism by endonucleases data at all investigated samples, except one - Bon-tzagan-nur. Besides the osmans from of the Lake Valley basin (Bon-tzagan-nur, Taytzyn-gol) have the obvious differences in arrangement of restriction sites of endonuclease Hinf I.

<< | >>
Источник: БИОЛОГИЧЕСКИЕ РЕСУРСЫ БЕЛОГО МОРЯ И ВНУТРЕННИХ ВОДОЕМОВ ЕВРОПЕЙСКОГО СЕВЕРА. Материалы XXVIII Международной конференции 5-8 октября 2009 г. г. Петрозаводск, Республика Карелия, Россия - Петрозаводск: КарНЦ РАН, 2009- 659 с.. 2009

Еще по теме ОСОБЕННОСТИ МИТОХОНДРИАЛЬНОГО ГЕНОМА НА ПРИМЕРЕ ЦИТОХРОМА B АЛТАЙСКИХ ОСМАНОВ (OREOLEUCISCUS WARPACHOWSKI) МОНГОЛИИ: